Быстрый заказ

Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TEK Информация о продукте «Клон cDNA»
Размер кДНК:3372bp
Описание кДНК:Full length Clone DNA of Mus musculus endothelial-specific receptor tyrosine kinase with C terminal His tag.
Синоним гена:Hyk, Tie2, tie-2, Cd202b, AA51
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51087-ACGRBS22240
Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51087-ACRRBS22240
Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51087-CFRBS20190
Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51087-CHRBS20190
Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51087-CMRBS20190
Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51087-CYRBS20190
Мышь Tie2/CD202b/TEK Джин клон кДНК в вектор клонированияMG51087-GRBS5130
Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51087-NFRBS20190
Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51087-NHRBS20190
Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51087-NMRBS20190
Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51087-NYRBS20190
Мышь Tie2/CD202b/TEK Джин ORF экспрессии кДНК клона плазмидыMG51087-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

TEK, or TIE-2, is an endothelial cell-specific receptor tyrosine kinase (RTK) that is known as a functioning molecule of vascular endothelial cells. TEK comprises a subfamily of RTK with TIE, and these two receptors play critical roles in vascular maturation, maintenance of integrity and remodeling. Targeted mutagenesis of both Tek and its agonistic ligand, Angiopoietin-1, result in embryonic lethality, demonstrating that the signal transduction pathways mediated by this receptor are crucial for normal embryonic development. TEK signaling is indispensable for the development of the embryonic vasculature and suggests that TEK signaling may also be required for the development of the tumor vasculature.

  • Jones N, et al. (1998) The Tek / Tie2 receptor signals through a novel Dok-related docking protein, Dok-R. Oncogene. 17(9): 1097-108.
  • Sato A, et al. (1998) Characterization of TEK receptor tyrosine kinase and its ligands, Angiopoietins, in human hematopoietic progenitor cells. Int Immunol. 10(8): 1217-27.
  • Huang L, et al. (1995) GRB2 and SH-PTP2: potentially important endothelial signaling molecules downstream of the TEK / TIE2 receptor tyrosine kinase. Oncogene. 11(10): 2097-103.
  • Size / Price
    Каталог: MG51087-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.