Быстрый заказ

Text Size:AAA

Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TCP1 Информация о продукте «Клон cDNA»
Размер кДНК:1671bp
Описание кДНК:Full length Clone DNA of Mus musculus t-complex protein 1 with N terminal His tag.
Синоним гена:CCT; p63; Cct1; Ccta; TRic; Tp63; Tcp-1; c-cpn; AI528772
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51966-ACGRBS16764
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51966-ACRRBS16764
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51966-ANGRBS16764
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51966-ANRRBS16764
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51966-CFRBS14711
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51966-CHRBS14711
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51966-CMRBS14711
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51966-CYRBS14711
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51966-NFRBS14711
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51966-NHRBS14711
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51966-NMRBS14711
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51966-NYRBS14711
Мышь TCP1 Джин клон кДНК в вектор клонированияMG51966-URBS5132
Мышь TCP1 Джин ORF экспрессии кДНК клона плазмидыMG51966-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51966-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.