After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TCF25 Информация о продукте «Клон cDNA»
Размер кДНК:1878bp
Описание кДНК:Full length Clone DNA of Mus musculus transcription factor 25 (basic helix-loop-helix) with N terminal His tag.
Синоним гена:Nulp1, mKIAA1049, D8Ertd325e, 1100001J13Rik, 1810041K11Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52531-ACGRBS16764
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52531-ACRRBS16764
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52531-ANGRBS16764
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52531-ANRRBS16764
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52531-CFRBS14711
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52531-CHRBS14711
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52531-CMRBS14711
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52531-CYRBS14711
Мышь TCF25 Джин клон кДНК в вектор клонированияMG52531-GRBS5132
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52531-NFRBS14711
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52531-NHRBS14711
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52531-NMRBS14711
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52531-NYRBS14711
Мышь TCF25 Джин ORF экспрессии кДНК клона плазмидыMG52531-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52531-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.