Быстрый заказ

Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь TCF25 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC046768.1
    Размер кДНК:1878bp
    Описание кДНК:Full length Clone DNA of Mus musculus transcription factor 25 (basic helix-loop-helix) with N terminal His tag.
    Синоним гена:Nulp1, mKIAA1049, D8Ertd325e, 1100001J13Rik, 1810041K11Rik
    Виды:Mouse
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TCF25 qPCR primers for gene expression analysis, MP202404 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52531-ACGRBS16760
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52531-ACRRBS16760
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52531-ANGRBS16760
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52531-ANRRBS16760
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52531-CFRBS14710
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52531-CHRBS14710
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52531-CMRBS14710
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52531-CYRBS14710
    Мышь TCF25 Джин клон кДНК в вектор клонированияMG52531-GRBS5130
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52531-NFRBS14710
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52531-NHRBS14710
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52531-NMRBS14710
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52531-NYRBS14710
    Мышь TCF25 Джин ORF экспрессии кДНК клона плазмидыMG52531-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».