Быстрый заказ

Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь TBRG1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_025289.3
    Размер кДНК:1221bp
    Описание кДНК:Full length Clone DNA of Mus musculus transforming growth factor beta regulated gene 1 with N terminal His tag.
    Синоним гена:Niam, Tb-5, AA408552, AA409675, mFLJ00213
    Виды:Mouse
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TBRG1 qPCR primers for gene expression analysis, MP201836 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51963-ACGRBS15400
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51963-ACRRBS15400
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51963-ANGRBS15400
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51963-ANRRBS15400
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51963-CFRBS13340
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51963-CHRBS13340
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51963-CMRBS13340
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51963-CYRBS13340
    Мышь TBRG1 Джин клон кДНК в вектор клонированияMG51963-GRBS5130
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51963-NFRBS13340
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51963-NHRBS13340
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51963-NMRBS13340
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51963-NYRBS13340
    Мышь TBRG1 Джин ORF экспрессии кДНК клона плазмидыMG51963-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51963-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».