TAF11 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

TAF11 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
636 bp
Description
Full length Clone DNA of Mouse TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TAF11 cDNA ORF Clone, Mouse, untagged: Alternative Names

1110038O14Rik cDNA ORF Clone, Mouse; 28kDa cDNA ORF Clone, Mouse; AI115401 cDNA ORF Clone, Mouse; AL024207 cDNA ORF Clone, Mouse; AW552398 cDNA ORF Clone, Mouse; PRO214 cDNA ORF Clone, Mouse; TAF2I cDNA ORF Clone, Mouse; TAFII28 cDNA ORF Clone, Mouse

TAF11 Background Information

TAF11 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait