Быстрый заказ

Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse TAF11 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AK050689.1
Размер кДНК:636bp
Описание кДНК:Full length Clone DNA of Mus musculus TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor.
Синоним гена:28kDa, TAF2I, PRO214, TAFII28, AI115401, AL024207, AW552398, 1110038O14Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51332-ACGRBS15400
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51332-ACRRBS15400
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51332-ANGRBS15400
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51332-ANRRBS15400
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51332-CFRBS13340
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51332-CHRBS13340
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51332-CMRBS13340
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51332-CYRBS13340
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51332-NFRBS13340
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51332-NHRBS13340
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51332-NMRBS13340
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51332-NYRBS13340
Мышь TAF11 Джин клон кДНК в вектор клонированияMG51332-URBS5130
Мышь TAF11 Джин ORF экспрессии кДНК клона плазмидыMG51332-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51332-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».