Быстрый заказ

Text Size:AAA

Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SMAD5 Информация о продукте «Клон cDNA»
Размер кДНК:1398bp
Описание кДНК:Full length Clone DNA of Mus musculus Mothers against decapentaplegic homolog 5 with N terminal His tag.
Синоним гена:Madh5, Msmad5
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50728-ACGRBS15400
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50728-ACRRBS15400
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50728-ANGRBS15400
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50728-ANRRBS15400
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50728-CFRBS13340
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50728-CHRBS13340
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50728-CMRBS13340
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50728-CYRBS13340
Мышь Smad5 Джин клон кДНК в вектор клонированияMG50728-GRBS5130
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50728-G-YRBS13340
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50728-NFRBS13340
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50728-NHRBS13340
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50728-NMRBS13340
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50728-NYRBS13340
Мышь Smad5 Джин ORF экспрессии кДНК клона плазмидыMG50728-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

SMAD5 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD5 is involved in the TGF-beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. It is also involved in cell signalling and modulates signals of bone morphogenetic proteins (BMP's). The binding of ligands causes the oligomerization and phosphorylation of the SMAD5 protein. SMAD5 is a receptor regulated SMAD (R-SMAD) and is activated by bone morphogenetic protein type 1 receptor kinase.

  • Vinayagam A. et al., 2011, Sci Signal. 4 (189): rs8.
  • Sangadala S. et al., 2007, J Biomol Struct Dyn. 25 (1): 11-23.
  • Riggins GJ. et al., 1996, Nat Genet. 13 (3): 347-9.
  • Size / Price
    Каталог: MG50728-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.