Smad2 cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

Smad2 cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1404 bp
Description
Full length Clone DNA of Mouse Mothers against decapentaplegic homolog 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Smad2 cDNA ORF Clone, Mouse, N-His tag: Alternative Names

7120426M23Rik cDNA ORF Clone, Mouse; Madh2 cDNA ORF Clone, Mouse; Madr2 cDNA ORF Clone, Mouse; mMad2 cDNA ORF Clone, Mouse; Smad-2 cDNA ORF Clone, Mouse

Smad2 Background Information

SMAD2 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD2 mediates the signal of the TGF-beta, and therefore regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. SMAD2 is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. SMAD2 is the downstream signal transducers of TGF-beta-1 in human dental pulp cells. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. Phosphorylated SMAD2 is able to form a complex with SMAD4 or SARA. These complexes accumulate in the cell nucleus, where they are directly participating in the regulation of gene expression.
Full Name
SMAD family member 2
References
  • Feng. et al., 2002, Mol Cell. 9 (1): 133-43.
  • Zhu Y. et al., 1997, J Biol Chem. 272 (15): 10035-40.
  • Zi Z. et al., 2012, FEBS Lett. 586 (14): 1921-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait