Быстрый заказ

Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь SMAD2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010754.4
Размер кДНК:1404bp
Описание кДНК:Full length Clone DNA of Mus musculus Mothers against decapentaplegic homolog 2 with N terminal His tag.
Синоним гена:Madh2, Madr2
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with Smad2 qPCR primers for gene expression analysis, MP200702 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50727-ACGRBS15400
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50727-ACRRBS15400
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50727-ANGRBS15400
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50727-ANRRBS15400
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50727-CFRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50727-CHRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50727-CMRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50727-CYRBS13340
Мышь Smad2 Джин клон кДНК в вектор клонированияMG50727-GRBS5130
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50727-NFRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50727-NHRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50727-NMRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50727-NYRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмидыMG50727-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SMAD2 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD2 mediates the signal of the TGF-beta, and therefore regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. SMAD2 is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. SMAD2 is the downstream signal transducers of TGF-beta-1 in human dental pulp cells. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. Phosphorylated SMAD2 is able to form a complex with SMAD4 or SARA. These complexes accumulate in the cell nucleus, where they are directly participating in the regulation of gene expression.

Ссылки
  • Feng. et al., 2002, Mol Cell. 9 (1): 133-43.
  • Zhu Y. et al., 1997, J Biol Chem. 272 (15): 10035-40.
  • Zi Z. et al., 2012, FEBS Lett. 586 (14): 1921-8.
  • Size / Price
    Каталог: MG50727-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».