After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SMAD2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_010754.4
Размер кДНК:1404bp
Описание кДНК:Full length Clone DNA of Mus musculus Mothers against decapentaplegic homolog 2 with N terminal His tag.
Синоним гена:Madh2, Madr2
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50727-ACGRBS15400
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50727-ACRRBS15400
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50727-ANGRBS15400
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50727-ANRRBS15400
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50727-CFRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50727-CHRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50727-CMRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50727-CYRBS13340
Мышь Smad2 Джин клон кДНК в вектор клонированияMG50727-GRBS5130
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50727-NFRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50727-NHRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50727-NMRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50727-NYRBS13340
Мышь Smad2 Джин ORF экспрессии кДНК клона плазмидыMG50727-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SMAD2 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD2 mediates the signal of the TGF-beta, and therefore regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. SMAD2 is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. SMAD2 is the downstream signal transducers of TGF-beta-1 in human dental pulp cells. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. Phosphorylated SMAD2 is able to form a complex with SMAD4 or SARA. These complexes accumulate in the cell nucleus, where they are directly participating in the regulation of gene expression.

Ссылки
  • Feng. et al., 2002, Mol Cell. 9 (1): 133-43.
  • Zhu Y. et al., 1997, J Biol Chem. 272 (15): 10035-40.
  • Zi Z. et al., 2012, FEBS Lett. 586 (14): 1921-8.
  • Size / Price
    Каталог: MG50727-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».