After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SERPINB8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_011459.3
Размер кДНК:1425bp
Описание кДНК:Full length Clone DNA of Mus musculus serine (or cysteine) peptdiase inhibitor, clade B, member 8 with N terminal Myc tag.
Синоним гена:CAP2, NK10, Spi8, CAP-2, ovalbumin, Serpinb8
Виды:Mouse
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50215-ACGRBS15400
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50215-ACRRBS15400
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50215-ANGRBS15400
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50215-ANRRBS15400
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50215-CFRBS13340
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50215-CHRBS13340
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50215-CMRBS13340
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50215-CYRBS13340
Мышь SerpinB8 Джин клон кДНК в вектор клонированияMG50215-MRBS5130
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50215-NFRBS13340
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50215-NHRBS13340
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50215-NMRBS13340
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50215-NYRBS13340
Мышь SerpinB8 Джин ORF экспрессии кДНК клона плазмидыMG50215-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner.
Mouse SerpinB8, also known as Cytoplasmic antiproteinase 2, Peptidase inhibitor 8, SerpinB8, PI-8, SERPINB8 and CAP2, is a member of the Serpin superfamily. SERPINB8 was broadly expressed. In normal neuroendocrine tissues, strongest SerpinB8 expression was detected in islets of Langerhans of the pancreas. Moderate SerpinB8 expression was observed in neuroendocrine cells of the thyroid, adrenal cortex, colon, and pituitary gland. In the pancreas, SerpinB8 is specifically expressed by insulin-producing beta cells, and can be used as an additional diagnostic immunohistochemical marker. Mouse SerpinB8 distribution alters during kidney regeneration, possibly to control a prohormone convertase involved in inflammation or tissue repair.

Ссылки
  • Sumi, Y. et al., 1989, J. Biochem. 106: 703-7.
  • Rawlings, N.D. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Filleur, S. et al., 2009, J Cell Biochem. 106 (5): 769-75.
  • de Koning, P.J. et al., 2009, Pancreas. 38 (4): 461-7.
  • Size / Price
    Каталог: MG50215-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».