Быстрый заказ

Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SYT13 Информация о продукте «Клон cDNA»
Размер кДНК:1281bp
Описание кДНК:Full length Clone DNA of Mus musculus synaptotagmin XIII with N terminal HA tag.
Синоним гена:AI549909, mKIAA1427, 5730409J20Rik
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51993-ACGRBS15396
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51993-ACRRBS15396
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51993-ANGRBS15396
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51993-ANRRBS15396
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51993-CFRBS13343
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51993-CHRBS13343
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51993-CMRBS13343
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51993-CYRBS13343
Мышь SYT13 Джин клон кДНК в вектор клонированияMG51993-GRBS5132
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51993-NFRBS13343
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51993-NHRBS13343
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51993-NMRBS13343
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51993-NYRBS13343
Мышь SYT13 Джин ORF экспрессии кДНК клона плазмидыMG51993-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51993-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.