STX5A cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

STX5A cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1068 bp
Description
Full length Clone DNA of Mouse syntaxin 5A with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

STX5A cDNA ORF Clone, Mouse, N-His tag: Alternative Names

0610031F24Rik cDNA ORF Clone, Mouse; D19Ertd627e cDNA ORF Clone, Mouse; Stx5 cDNA ORF Clone, Mouse

STX5A Background Information

Full Name
syntaxin 5A
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait