After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse STMN4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_019675.2
Размер кДНК:570bp
Описание кДНК:Full length Clone DNA of Mus musculus stathmin-like 4 with C terminal His tag.
Синоним гена:RB3, Lagl, R75359
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52287-ACGRBS15400
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52287-ACRRBS15400
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52287-ANGRBS15400
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52287-ANRRBS15400
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52287-CFRBS13340
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52287-CHRBS13340
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52287-CMRBS13340
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52287-CYRBS13340
Мышь STMN4 Джин клон кДНК в вектор клонированияMG52287-GRBS5130
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52287-NFRBS13340
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52287-NHRBS13340
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52287-NMRBS13340
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52287-NYRBS13340
Мышь STMN4 Джин ORF экспрессии кДНК клона плазмидыMG52287-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52287-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».