Быстрый заказ

Text Size:AAA

Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse STAT5B Информация о продукте «Клон cDNA»
Размер кДНК:2361bp
Описание кДНК:Full length Clone DNA of Mus musculus signal transducer and activator of transcription 5B with C terminal HA tag.
Синоним гена:Stat5b
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51116-ACGRBS16760
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51116-ACRRBS16760
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51116-ANGRBS16760
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51116-ANRRBS16760
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51116-CFRBS14710
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51116-CHRBS14710
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51116-CMRBS14710
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51116-CYRBS14710
Мышь STAT5b Джин клон кДНК в вектор клонированияMG51116-GRBS5130
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51116-NFRBS14710
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51116-NHRBS14710
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51116-NMRBS14710
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51116-NYRBS14710
Мышь STAT5b Джин ORF экспрессии кДНК клона плазмидыMG51116-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51116-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.