STAT5a cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

STAT5a cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2382 bp
Description
Full length Clone DNA of Mouse signal transducer and activator of transcription 5A with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

STAT5a cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

AA959963 cDNA ORF Clone, Mouse; STAT5 cDNA ORF Clone, Mouse

STAT5a Background Information

Signal transducers and activators of transcription 5 (STAT5) has been shown to be involved in a variety of cellular processes, including survival, proliferation, invasion, angiogenesis and immune evasion and is frequently overexpressed in human solid tumors and blood malignancies. STAT5a/b species are well known as transcription factors that regulate nuclear gene expression. Using enucleated cytoplasts for a nongenomic mechanism(s) underlying the cystic change in ER structure elicited by STAT5a/b knockdown.
Full Name
signal transducer and activator of transcription 5A
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait