After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ST6GAL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_145933.3
Размер кДНК:1212bp
Описание кДНК:Full length Clone DNA of Mus musculus beta galactoside alpha 2,6 sialyltransferase 1 with N terminal His tag.
Синоним гена:Siat1, St6gal, St6galI, AW742324, MGC116663, St6gal1
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50740-ACGRBS15400
Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50740-ACRRBS15400
Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50740-CFRBS13340
Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50740-CHRBS13340
Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50740-CMRBS13340
Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50740-CYRBS13340
Мышь ST6GAL1/ST6GAL-I Джин клон кДНК в вектор клонированияMG50740-GRBS5130
Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50740-NFRBS13340
Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50740-NHRBS13340
Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50740-NMRBS13340
Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50740-NYRBS13340
Мышь ST6GAL1/ST6GAL-I Джин ORF экспрессии кДНК клона плазмидыMG50740-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Beta-galactoside alpha-2,6-sialyltransferase 1, also known as B-cell antigen CD75, Sialyltransferase 1, CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase 1, ST6GAL1 and SIAT1, is a single-pass type II membrane protein which belongs to the glycosyltransferase 29 family. Sialyltransferases are key enzymes in the biosynthesis of sialoglycoconjugates that catalyze the transfer of sialic residue from its activated form to an oligosaccharidic acceptor. ST6GAL1 / SIAT1 is normally found in the?Golgi?but which can be proteolytically processed to a soluble form. It is involved in the generation of the cell-surface carbohydrate determinants and differentiation antigens HB-6, CDw75, and CD76. β-Galactoside α2,6-sialyltransferases ST6GAL1 and ST6GAL2 are the two unique members of the ST6GAL family described in higher vertebrates. ST6GAL1 / SIAT1 transfers sialic acid from the donor of substrate CMP-sialic acid to galactose containing acceptor substrates.

Ссылки
  • Collins,B.E. et al., 2006, Nat Immunol. 7(2):199-206.
  • Videira,P.A. et al., 2008, Glycoconj J. 25(3): 259-68.
  • Petit,D. et al., 2010, J Biol Chem. 285(49): 38399-414.
  • Kroes,R.A. et al., 2010, Proc Natl Acad Sci USA.107(28):12646-51.
  • Size / Price
    Каталог: MG50740-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».