After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse ST13 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_133726.2
Размер кДНК:1116bp
Описание кДНК:Full length Clone DNA of Mus musculus suppression of tumorigenicity 13.
Синоним гена:HIP, HOP, p48, SNC6, HSPABP, HSPABP1, PRO0786, AW555194, 1110007I03Rik, 3110002K08Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52461-ACGRBS15400
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52461-ACRRBS15400
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52461-ANGRBS15400
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52461-ANRRBS15400
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52461-CFRBS13340
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52461-CHRBS13340
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52461-CMRBS13340
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52461-CYRBS13340
Мышь ST13 Джин клон кДНК в вектор клонированияMG52461-GRBS5130
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52461-NFRBS13340
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52461-NHRBS13340
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52461-NMRBS13340
Мышь ST13 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52461-NYRBS13340
Мышь ST13 Джин ORF экспрессии кДНК клона плазмидыMG52461-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52461-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».