Быстрый заказ

Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SRFBP1 Информация о продукте «Клон cDNA»
Размер кДНК:1326bp
Описание кДНК:Full length Clone DNA of Mus musculus serum response factor binding protein 1 with C terminal Myc tag.
Синоним гена:p49/STRAP, 2810036K01Rik
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51646-ACGRBS15400
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51646-ACRRBS15400
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51646-ANGRBS15400
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51646-ANRRBS15400
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51646-CFRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51646-CHRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51646-CMRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51646-CYRBS13340
Мышь SRFBP1 (p49/STRAP) Джин клон кДНК в вектор клонированияMG51646-GRBS5130
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51646-NFRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51646-NHRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51646-NMRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51646-NYRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмидыMG51646-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

SRFBP1 contains 7 WD repeats and belongs to the WD repeat STRAP family. SRFBP1 may play a role in the cellular distribution of the SMN complex. The SMN complex plays an essential role in spliceosomal snRNP assembly in the cytoplasm and is required for pre-mRNA splicing in the nucleus. SRFBP1 negatively regulates TGF-beta signaling but positively regulates the PDPK1 kinase activity by enhancing its autophosphorylation and by significantly reducing the association of PDPK1 with 14-3-3 protein. SRFBP1 may be involved in regulating transcriptional activation of cardiac genes during the aging process. It also may play a role in biosynthesis and/or processing of SLC2A4 in adipose cells.

  • Datta PK, et al. (1999) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (1998) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (2000) STRAP and Smad7 synergize in the inhibition of transforming growth factor beta signaling. Mol Cell Biol. 20(9):3157-67.
  • Size / Price
    Каталог: MG51646-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.