After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SRFBP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_026040.3
Размер кДНК:1326bp
Описание кДНК:Full length Clone DNA of Mus musculus serum response factor binding protein 1 with C terminal Flag tag.
Синоним гена:p49/STRAP, 2810036K01Rik
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51646-ACGRBS15400
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51646-ACRRBS15400
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51646-ANGRBS15400
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51646-ANRRBS15400
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51646-CFRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51646-CHRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51646-CMRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51646-CYRBS13340
Мышь SRFBP1 (p49/STRAP) Джин клон кДНК в вектор клонированияMG51646-GRBS5130
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51646-NFRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51646-NHRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51646-NMRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51646-NYRBS13340
Мышь SRFBP1 (p49/STRAP) Джин ORF экспрессии кДНК клона плазмидыMG51646-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SRFBP1 contains 7 WD repeats and belongs to the WD repeat STRAP family. SRFBP1 may play a role in the cellular distribution of the SMN complex. The SMN complex plays an essential role in spliceosomal snRNP assembly in the cytoplasm and is required for pre-mRNA splicing in the nucleus. SRFBP1 negatively regulates TGF-beta signaling but positively regulates the PDPK1 kinase activity by enhancing its autophosphorylation and by significantly reducing the association of PDPK1 with 14-3-3 protein. SRFBP1 may be involved in regulating transcriptional activation of cardiac genes during the aging process. It also may play a role in biosynthesis and/or processing of SLC2A4 in adipose cells.

Ссылки
  • Datta PK, et al. (1999) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (1998) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (2000) STRAP and Smad7 synergize in the inhibition of transforming growth factor beta signaling. Mol Cell Biol. 20(9):3157-67.
  • Size / Price
    Каталог: MG51646-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».