After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SRC Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_009271.3
Размер кДНК:1626bp
Описание кДНК:Full length Clone DNA of Mus musculus Rous sarcoma oncogene transcript variant 1 with C terminal HA tag.
Синоним гена:AW259666, pp60c-src, Src
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51118-ACGRBS16760
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51118-ACRRBS16760
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51118-ANGRBS16760
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51118-ANRRBS16760
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51118-CFRBS14710
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51118-CHRBS14710
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51118-CMRBS14710
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51118-CYRBS14710
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин клон кДНК в вектор клонированияMG51118-GRBS5130
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51118-G-FRBS14710
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51118-NFRBS14710
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51118-NHRBS14710
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51118-NMRBS14710
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51118-NYRBS14710
Мышь SRC/Proto-oncogene c-Src transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыMG51118-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

Ссылки
  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • Size / Price
    Каталог: MG51118-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».