Быстрый заказ

Text Size:AAA

Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SPP1 Информация о продукте «Клон cDNA»
Размер кДНК:885bp
Описание кДНК:Full length Clone DNA of Mus musculus secreted phosphoprotein 1 with N terminal His tag.
Синоним гена:OP, Bsp, Eta, Opn, Ric, BNSP, BSPI, Opnl, Apl-1, ETA-1, Spp-1, AA960535, AI790405, minopontin
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50116-ACGRBS15400
Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50116-ACRRBS15400
Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50116-CFRBS13340
Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50116-CHRBS13340
Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50116-CMRBS13340
Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50116-CYRBS13340
Мышь OPN/Osteopontin Джин клон кДНК в вектор клонированияMG50116-MRBS5130
Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50116-NFRBS13340
Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50116-NHRBS13340
Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50116-NMRBS13340
Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50116-NYRBS13340
Мышь OPN/Osteopontin Джин ORF экспрессии кДНК клона плазмидыMG50116-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Osteopontin, also known as Secreted phosphoprotein 1, Bone sialoprotein 1, BSP-1, OPN, and SPP1, is a member of the osteopontin family and a SIBLING glycoprotein. Osteopontin has been classified as T-helper 1 cytokine and thus believed to exacerbate inflammation in several chronic inflammatory diseases, including atherosclerosis. Besides proinflammatory functions, physiologically Osteopontin is a potent inhibitor of mineralization, it prevents ectopic calcium deposits and is a potent inducible inhibitor of vascular calcification. Osteopontin is expressed and secreted by various cells, and has a role in cell adhesion, chemotaxis, prevention of apoptosis, invasion, migration and anchorage-independent growth of tumor cells. Osteopontin recruitment functions of inflammatory cells are thought to be mediated through its adhesive domains, especially the arginine-glycine-aspartate (RGD) sequence that interacts with several integrin heterodimers. Osteopontin has emerged as a potential biomarker and mediator in cardiovascular disease. In the context of atherosclerosis, OPN is generally regarded as a proinflammatory and proatherogenic molecule. However, the role of OPN in vascular calcification (VC), which is closely related to chronic and active inflammation, is that of a negative regulator because it is an inhibitor of calcification and an active inducer of decalcification. Extensive research has demonstrated the pivotal participation of Osteopontin in the regulation of cell signaling which controls neoplastic and malignant transformation. The elevated expression of Osteopontin has been observed in a variety of cancers. It has been linked with tumor metastasis and signifies a poor prognosis for the patient.

  • Scatena M, et al. (2007) Osteopontin: a multifunctional molecule regulating chronic inflammation and vascular disease. Arterioscler Thromb Vasc Biol. 27(11): 2302-9.
  • Johnston NI, et al. (2008) Osteopontin as a target for cancer therapy. Front Biosci. 13: 4361-72.
  • Cho HJ, et al. (2009) Osteopontin: a multifunctional protein at the crossroads of inflammation, atherosclerosis, and vascular calcification. Curr Atheroscler Rep. 11(3): 206-13.
  • Waller AH, et al. (2010) Osteopontin in cardiovascular disease: a potential therapeutic target. Cardiol Rev. 18(3): 125-31.
  • Shevde LA, et al. (2010) Osteopontin: an effector and an effect of tumor metastasis. Curr Mol Med. 10(1): 71-81.
  • Size / Price
    Каталог: MG50116-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.