Быстрый заказ

Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь SPN Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001037810.1
    Размер кДНК:1188bp
    Описание кДНК:Full length Clone DNA of Mus musculus sialophorin with N terminal His tag.
    Синоним гена:Cd43, Ly48, Galgp, Ly-48, A630014B01Rik, Spn
    Виды:Mouse
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SPN qPCR primers for gene expression analysis, MP200710 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50735-ACGRBS15400
    Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50735-ACRRBS15400
    Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50735-CFRBS13340
    Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50735-CHRBS13340
    Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50735-CMRBS13340
    Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50735-CYRBS13340
    Мышь SPN/CD43 Джин клон кДНК в вектор клонированияMG50735-GRBS5130
    Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50735-NFRBS13340
    Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50735-NHRBS13340
    Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50735-NMRBS13340
    Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50735-NYRBS13340
    Мышь SPN/CD43 Джин ORF экспрессии кДНК клона плазмидыMG50735-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    CD43 is an abundantly expressed molecule on the T-cell surface that shows distinct localization to the migrating T-cell uropod and the distal pole complex (DPC) opposite the immunological synapse via association with the ezrin-radixin-moesin (ERM) family of actin regulatory proteins. CD43 has a 235-amino acid (aa) extracellular domain, a 23-aa transmembrane domain, and a 123-aa cytoplasmic domain, all encoded by a single exon. The intracytoplasmic region of the protein is necessary to transduce signals; it is rich in potentially phosphorylable threonines and serines but lacks tyrosine residues as well as catalytic activity. CD43 engagement on human peripheral blood T cells and monocytes leads to cell activation and proliferation through the generation of second messengers such as diacylglycerol and inositol phosphates, protein kinase C (PKC) activation and Ca2+ mobilization. In addition, CD43 ligation on human T cells induces the association of CD43 with Src family kinases, presumably through the interaction of their Src homology 3 domain with a proline-rich region of the CD43 intracytoplasmic tail. This molecule has been implicated in T cell activation, enhancing T cell response to allogeneic or mitogenic stimulation and CD43-specific signals have been reported to be sufficient to activate T cells in the absence of T cell receptor (TCR) engagement. In summary, CD43 regulates multiple T-cell functions, including T-cell activation, proliferation, apoptosis, and migration.

    Ссылки
  • . Layseca-Espinosa E, et al. (2003) Journal of Leukocyte Biology. 74(6): 1083-93.
  • Cannon JL, et al. (2011) Mol Biol Cell. 22(7):954-63.
  • Pallant A,et al. (1989). Proc Natl Acad Sci. 86 (4): 1328–32.
  • Size / Price
    Каталог: MG50735-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».