SPARC cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

SPARC cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
909 bp
Description
Full length Clone DNA of Mouse secreted acidic cysteine rich glycoprotein with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SPARC cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

AA517111 cDNA ORF Clone, Mouse; BM-40 cDNA ORF Clone, Mouse; ON cDNA ORF Clone, Mouse; RP23-465I4.1 cDNA ORF Clone, Mouse

SPARC Background Information

Secreted protein acidic and rich in cysteine (SPARC), also known as Osteonectin (ON), is a member of the SPARC family. SPARC consists of three domains: a EF-hand domain, a follistatin-like domain and a Kazal-like domain, and each of which has independent activity and unique properties. The activity of SPARC is context- and cell-type-dependent, which is highlighted by the fact that SPARC has shown seemingly contradictory effects on tumor progression in both clinical correlative studies and in animal models. The location of SPARC in the nuclear matrix of certain proliferating cells, but only in the cytosol of postmitotic neurons, indicates potential functions of SPARC as a nuclear protein, which might be involved in the regulation of cell cycle progression and mitosis. It functions not only to modulate cell-cell and cell-matrix interactions, but its de-adhesive and growth inhibitory properties in non-transformed cells have led to studies to assess its role in cancer. Its divergent actions reflect the complexity of this protein, because in certain types of cancers, such as melanomas and gliomas, SPARC is associated with a highly aggressive tumor phenotype, while in others, mainly ovarian, neuroblastomas and colorectal cancers, SPARC may function as a tumor suppressor. Recent studies have also demonstrated a role for SPARC in sensitizing therapy-resistant cancers. Notably, SPARC is linked to human obesity.
Full Name
secreted protein, acidic, cysteine-rich (osteonectin)
References
  • Yan Q, et al. (1999) SPARC, a matricellular glycoprotein with important biological functions. J Histochem Cytochem. 47(12): 1495-506.
  • Brekken RA, et al. (2000) SPARC, a matricellular protein: at the crossroads of cell-matrix. Matrix Biol. 19(7): 569-80.
  • Tai IT, et al. (2008) SPARC in cancer biology: its role in cancer progression and potential for therapy. Drug Resist Updat. 11(6): 231-46.
  • Podhajcer OL, et al. (2008) The role of the matricellular protein SPARC in the dynamic interaction between the tumor and the host. Cancer Metastasis Rev. 27(3): 523-37.
  • Kos K, et al. (2010) SPARC: a key player in the pathologies associated with obesity and diabetes. Nat Rev Endocrinol. 6(4): 225-35.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait