After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SPAG9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001025429.1
Размер кДНК:3507bp
Описание кДНК:Full length Clone DNA of Mus musculus sperm associated antigen 9 with N terminal His tag.
Синоним гена:JLP, Jip4, syd1, JSAP2, JSAP2a, AW552012, Mapk8ip4, 3110018C07Rik, 4733401I23Rik, 4831406C20Rik
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51967-ACGRBS25659
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51967-ACRRBS25659
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51967-ANGRBS25659
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51967-ANRRBS25659
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51967-CFRBS23607
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51967-CHRBS23607
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51967-CMRBS23607
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51967-CYRBS23607
Мышь SPAG9 Джин клон кДНК в вектор клонированияMG51967-GRBS5132
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51967-NFRBS23607
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51967-NHRBS23607
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51967-NMRBS23607
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51967-NYRBS23607
Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмидыMG51967-UTRBS23607
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51967-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».