Быстрый заказ

Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь SPAG9 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001025429.1
    Размер кДНК:3507bp
    Описание кДНК:Full length Clone DNA of Mus musculus sperm associated antigen 9 with N terminal His tag.
    Синоним гена:JLP, Jip4, syd1, JSAP2, JSAP2a, AW552012, Mapk8ip4, 3110018C07Rik, 4733401I23Rik, 4831406C20Rik
    Виды:Mouse
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SPAG9 qPCR primers for gene expression analysis, MP201840 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51967-ACGRBS25660
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51967-ACRRBS25660
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51967-ANGRBS25660
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51967-ANRRBS25660
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51967-CFRBS23610
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51967-CHRBS23610
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51967-CMRBS23610
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51967-CYRBS23610
    Мышь SPAG9 Джин клон кДНК в вектор клонированияMG51967-GRBS5130
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51967-NFRBS23610
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51967-NHRBS23610
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51967-NMRBS23610
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51967-NYRBS23610
    Мышь SPAG9 Джин ORF экспрессии кДНК клона плазмидыMG51967-UTRBS23610
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51967-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».