After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SOD1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_011434.1
Размер кДНК:465bp
Описание кДНК:Full length Clone DNA of Mus musculus superoxide dismutase 1, soluble with N terminal His tag.
Синоним гена:Ipo1, SODC, Ipo-1, Sod-1, CuZnSOD, Cu/Zn-SOD, B430204E11Rik
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52544-ACGRBS15400
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52544-ACRRBS15400
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52544-ANGRBS15400
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52544-ANRRBS15400
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52544-CFRBS13340
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52544-CHRBS13340
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52544-CMRBS13340
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52544-CYRBS13340
Мышь SOD1 Джин клон кДНК в вектор клонированияMG52544-GRBS5130
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52544-NFRBS13340
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52544-NHRBS13340
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52544-NMRBS13340
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52544-NYRBS13340
Мышь SOD1 Джин ORF экспрессии кДНК клона плазмидыMG52544-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SOD1 belongs to the Cu-Zn superoxide dismutase family. It binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. SOD1 destroys radicals which are normally produced within the cells and which are toxic to biological systems. Defects in SOD1 are the cause of amyotrophic lateral sclerosis type 1 (ALS1). ALS1 is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Sensory abnormalities are absent. Death usually occurs within 2 to 5 years. The etiology of amyotrophic lateral sclerosis is likely to be multifactorial, involving both genetic and environmental factors. The disease is inherited in 5-10% of cases leading to familial forms.

Ссылки
  • Murakami K, et al. (2011) SOD1 (copper/zinc superoxide dismutase) deficiency drives amyloid β protein oligomerization and memory loss in mouse model of Alzheimer disease. J Biol Chem. 286(52):44557-68.
  • Thompson M, et al. (2012) Paradoxical roles of serine racemase and D-serine in the G93A mSOD1 mouse model of amyotrophic lateral sclerosis. J Neurochem. 120(4):598-610.
  • Magrané J, et al. (2012) Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons. J Neurosci. 32(1):229-42.
  • Gertz B, et al. (2012) Nuclear localization of human SOD1 and mutant SOD1-specific disruption of survival motor neuron protein complex in transgenic amyotrophic lateral sclerosis mice. J Neuropathol Exp Neurol. 71(2):162-77.
  • Size / Price
    Каталог: MG52544-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».