Быстрый заказ

Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь SNX2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_026386.1
    Размер кДНК:1560bp
    Описание кДНК:Full length Clone DNA of Mus musculus sorting nexin 2 with C terminal His tag.
    Синоним гена:0610030A03Rik
    Виды:Mouse
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SNX2 qPCR primers for gene expression analysis, MP202145 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52272-ACGRBS16760
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52272-ACRRBS16760
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52272-ANGRBS16760
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52272-ANRRBS16760
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52272-CFRBS14710
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52272-CHRBS14710
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52272-CMRBS14710
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52272-CYRBS14710
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52272-NFRBS14710
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52272-NHRBS14710
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52272-NMRBS14710
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52272-NYRBS14710
    Мышь SNX2 Джин клон кДНК в вектор клонированияMG52272-URBS5130
    Мышь SNX2 Джин ORF экспрессии кДНК клона плазмидыMG52272-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52272-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».