Быстрый заказ

Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SNX2 Информация о продукте «Клон cDNA»
Размер кДНК:1560bp
Описание кДНК:Full length Clone DNA of Mus musculus sorting nexin 2 with C terminal His tag.
Синоним гена:0610030A03Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52272-ACGRBS16760
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52272-ACRRBS16760
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52272-ANGRBS16760
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52272-ANRRBS16760
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52272-CFRBS14710
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52272-CHRBS14710
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52272-CMRBS14710
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52272-CYRBS14710
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52272-NFRBS14710
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52272-NHRBS14710
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52272-NMRBS14710
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52272-NYRBS14710
Мышь SNX2 Джин клон кДНК в вектор клонированияMG52272-URBS5130
Мышь SNX2 Джин ORF экспрессии кДНК клона плазмидыMG52272-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.