Быстрый заказ

Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SNX15 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_026912.1
Размер кДНК:1014bp
Описание кДНК:Full length Clone DNA of Mus musculus sorting nexin 15 with N terminal HA tag.
Синоним гена:1500032B08Rik; E130013C21Rik
Виды:Mouse
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52032-ACGRBS15400
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52032-ACRRBS15400
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52032-ANGRBS15400
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52032-ANRRBS15400
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52032-CFRBS13340
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52032-CHRBS13340
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52032-CMRBS13340
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52032-CYRBS13340
Mouse SNX15 Gene cDNA clone plasmidMG52032-GRBS3620
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52032-NFRBS13340
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52032-NHRBS13340
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52032-NMRBS13340
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52032-NYRBS13340
Мышь SNX15 Джин клон кДНК в вектор клонированияMG52032-URBS5130
Мышь SNX15 Джин ORF экспрессии кДНК клона плазмидыMG52032-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52032-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».