SNURF cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

SNURF cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
216 bp
Description
Full length Clone DNA of Mouse SNRPN upstream reading frame.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SNURF cDNA ORF Clone, Mouse, untagged: Alternative Names

2410045I01Rik cDNA ORF Clone, Mouse; Snrpn cDNA ORF Clone, Mouse

SNURF Background Information

Full Name
SNRPN upstream reading frame
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait