Быстрый заказ

Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь SNURF Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_033174.3
    Размер кДНК:216bp
    Описание кДНК:Full length Clone DNA of Mus musculus SNRPN upstream reading frame.
    Синоним гена:Snrpn, 2410045I01Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SNURF qPCR primers for gene expression analysis, MP201219 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51342-ACGRBS15400
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51342-ACRRBS15400
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51342-ANGRBS15400
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51342-ANRRBS15400
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51342-CFRBS13340
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51342-CHRBS13340
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51342-CMRBS13340
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51342-CYRBS13340
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51342-NFRBS13340
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51342-NHRBS13340
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51342-NMRBS13340
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51342-NYRBS13340
    Мышь SNURF Джин клон кДНК в вектор клонированияMG51342-URBS5130
    Мышь SNURF Джин ORF экспрессии кДНК клона плазмидыMG51342-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51342-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».