After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SMPX Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_025357.3
Размер кДНК:258bp
Описание кДНК:Full length Clone DNA of Mus musculus small muscle protein, X-linked.
Синоним гена:Csl, 1010001C09Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51378-ACGRBS15400
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51378-ACRRBS15400
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51378-ANGRBS15400
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51378-ANRRBS15400
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51378-CFRBS13340
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51378-CHRBS13340
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51378-CMRBS13340
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51378-CYRBS13340
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51378-NFRBS13340
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51378-NHRBS13340
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51378-NMRBS13340
Мышь SMPX Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51378-NYRBS13340
Мышь SMPX Джин клон кДНК в вектор клонированияMG51378-URBS5130
Мышь SMPX Джин ORF экспрессии кДНК клона плазмидыMG51378-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51378-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».