After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SMPDL3A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_020561.2
Размер кДНК:1338bp
Описание кДНК:Full length Clone DNA of Mus musculus sphingomyelin phosphodiesterase, acid-like 3A with C terminal His tag.
Синоним гена:ASM3A, ASML3, ASML3A, AI529588, 0610010C24Rik
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52271-ACGRBS15400
Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52271-ACRRBS15400
Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52271-CFRBS13340
Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52271-CHRBS13340
Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52271-CMRBS13340
Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52271-CYRBS13340
Мышь ASM3A / SMPDL3A Джин клон кДНК в вектор клонированияMG52271-GRBS5130
Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52271-NFRBS13340
Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52271-NHRBS13340
Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52271-NMRBS13340
Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52271-NYRBS13340
Мышь ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмидыMG52271-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SMPDL3A gene is a novel liver X receptor (LXR) -regulated gene, with an LXR response element within its promoter. The induction of SMPDL3A is LXR-dependent and is restricted to human blood cells with no induction observed in mouse cellular systems. LXR α and LXRβ function as physiological sensors of cholesterol metabolites (oxysterols), regulating key genes involved in cholesterol and lipid metabolism. LXRs have been extensively studied in both human and rodent cell systems, revealing their potential therapeutic value in the contexts of atherosclerosis and inflammatory diseases. The LXR genome landscape has been investigated in murine macrophages but not in human THP-1 cells, which represent one of the frequently used monocyte/macrophage cell systems to study immune responses.

Ссылки
  • Wright KO, et al. (2002) Increased expression of the acid sphingomyelinase-like protein ASML3a in bladder tumors. J Urol. 168(6):2645-9.
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Mungall AJ, et al. (2003) The DNA sequence and analysis of human chromosome 6. Nature. 425(6960):805-11.
  • Size / Price
    Каталог: MG52271-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».