Быстрый заказ

Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SLITRK1 Информация о продукте «Клон cDNA»
Размер кДНК:2091bp
Описание кДНК:Full length Clone DNA of Mus musculus SLIT and NTRK-like family, member 1 with C terminal Myc tag.
Синоним гена:3200001I04Rik, Slitrk1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50382-ACGRBS16760
Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50382-ACRRBS16760
Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50382-CFRBS14710
Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50382-CHRBS14710
Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50382-CMRBS14710
Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50382-CYRBS14710
Мышь SLITRK1 Джин клон кДНК в вектор клонированияMG50382-MRBS5130
Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50382-NFRBS14710
Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50382-NHRBS14710
Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50382-NMRBS14710
Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50382-NYRBS14710
Мышь SLITRK1 Джин ORF экспрессии кДНК клона плазмидыMG50382-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

SLITRK1 (Slit and Trk-like family member 1) is a integral membrane protein belonging to the SLITRK family consists of at least 6 members (SLITRK1-6). They are named and characterized by the presence of two leucine-rich repeats (LRRs) in the extracellular domain similar to those found in a secreted axonal growth-controlling protein, Slit, as well as a C-terminal domain with homology to Trk neurotrophin tyrosine kinase receptors. Expression of SLITRKs are highly restricted to neural tissues, and are identified as the neuronal components modulating the neurite outgrowth. More specifically, SLITRK1 expression is found in the mature neurons of the cerebrum, thalamus and hippocampus, and induces unipolar neurites in cultured neuronal cells. Human SLITRK1 is a 696 amino acid precursor protein, and one truncating frameshift mutation (448 aa) has been linked to Tourette's syndrome, a genetically influenced developmental neuropsychiatric disorder characterized by chronic vocal and motor tics. In addition, all SLITRK genes are differentially expressed in brain tumors, such as astrocytoma, oligodendroglioma, glioblastoma, and are suggested to be useful molecular indicators of brain tumor properties.


1. Aruga, J. and Mikoshiba, K. 2003, Mol. Cell. Neurosci. 24: 117-129.

2. Aruga, J. et al., 2003, Gene. 315: 87-94.

3. Abelson, J.F. et al., 2005, Science. 310: 317-320.

4. Grados, M.A. and Walkup. J.T. 2006, Trends. Genet. 22: 291-293.

Size / Price
Каталог: MG50382-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.