SLIT2 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

SLIT2 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
4566 bp
Description
Full length Clone DNA of Mouse slit homolog 2 (Drosophila).
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SLIT2 cDNA ORF Clone, Mouse, untagged: Alternative Names

Drad-1 cDNA ORF Clone, Mouse; E030015M03Rik cDNA ORF Clone, Mouse; E130320P19Rik cDNA ORF Clone, Mouse; mKIAA4141 cDNA ORF Clone, Mouse; Slil3 cDNA ORF Clone, Mouse; slit-2 cDNA ORF Clone, Mouse

SLIT2 Background Information

Add to Cart Successfully Add to Cart Failed