Быстрый заказ

Мышь SLIT2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SLIT2 Информация о продукте «Клон cDNA»
Размер кДНК:4566bp
Описание кДНК:Full length Clone DNA of Mus musculus slit homolog 2 (Drosophila) with C terminal His tag.
Синоним гена:Slil3, Drad-1, KIAA4141, mKIAA4141, E030015M03Rik, E130320P19Rik, Slit2
Участок рестрикции:KpnI + XbaI (6kb + 4.62kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 819 C/T, 1512 T/C, 1716 C/T, 2217 T/C and 3610 A/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse SLIT2 Gene Plasmid Map
Mouse SLIT2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь SLIT2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Product nameProduct name
Size / Price
Каталог: MG50443-CH
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Mouse SLIT2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.