After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SLC6A13 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_144512.2
Размер кДНК:1809bp
Описание кДНК:Full length Clone DNA of Mus musculus solute carrier family 6 (neurotransmitter transporter, GABA), member 13.
Синоним гена:GAT3, Gat2, Gabt3
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52460-ACGRBS16760
Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52460-ACRRBS16760
Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52460-CFRBS14710
Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52460-CHRBS14710
Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52460-CMRBS14710
Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52460-CYRBS14710
Мышь SLC6A13 Джин клон кДНК в вектор клонированияMG52460-GRBS5130
Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52460-NFRBS14710
Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52460-NHRBS14710
Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52460-NMRBS14710
Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52460-NYRBS14710
Мышь SLC6A13 Джин ORF экспрессии кДНК клона плазмидыMG52460-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52460-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».