After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SLC41A1 Информация о продукте «Клон cDNA»
Размер кДНК:1539bp
Описание кДНК:Full length Clone DNA of Mus musculus solute carrier family 41, member 1 with N terminal His tag.
Синоним гена:AI573938; B230315F01Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52545-ACGRBS16760
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52545-ACRRBS16760
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52545-ANGRBS16760
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52545-ANRRBS16760
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52545-CFRBS14710
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52545-CHRBS14710
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52545-CMRBS14710
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52545-CYRBS14710
Mouse SLC41A1 Gene cDNA clone plasmidMG52545-GRBS5130
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52545-NFRBS14710
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52545-NHRBS14710
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52545-NMRBS14710
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52545-NYRBS14710
Мышь SLC41A1 Джин клон кДНК в вектор клонированияMG52545-URBS5130
Мышь SLC41A1 Джин ORF экспрессии кДНК клона плазмидыMG52545-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52545-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.