After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SLC39A7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001077709.1
Размер кДНК:1431bp
Описание кДНК:Full length Clone DNA of Mus musculus solute carrier family 39 (zinc transporter), member 7 with N terminal His tag.
Синоним гена:Ke4, Ke-4, Zip7, Ring5, H-2Ke4, H2-Ke4, AA408174, AI117660, AL024048
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52540-ACGRBS15400
Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52540-ACRRBS15400
Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52540-CFRBS13340
Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52540-CHRBS13340
Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52540-CMRBS13340
Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52540-CYRBS13340
Мышь SLC39A7 Джин клон кДНК в вектор клонированияMG52540-GRBS5130
Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52540-NFRBS13340
Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52540-NHRBS13340
Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52540-NMRBS13340
Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52540-NYRBS13340
Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмидыMG52540-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52540-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».