Быстрый заказ

Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь SLC39A7 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001077709.1
    Размер кДНК:1431bp
    Описание кДНК:Full length Clone DNA of Mus musculus solute carrier family 39 (zinc transporter), member 7 with N terminal His tag.
    Синоним гена:Ke4, Ke-4, Zip7, Ring5, H-2Ke4, H2-Ke4, AA408174, AI117660, AL024048
    Виды:Mouse
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SLC39A7 qPCR primers for gene expression analysis, MP202413 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52540-ACGRBS15400
    Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52540-ACRRBS15400
    Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52540-CFRBS13340
    Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52540-CHRBS13340
    Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52540-CMRBS13340
    Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52540-CYRBS13340
    Мышь SLC39A7 Джин клон кДНК в вектор клонированияMG52540-GRBS5130
    Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52540-NFRBS13340
    Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52540-NHRBS13340
    Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52540-NMRBS13340
    Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52540-NYRBS13340
    Мышь SLC39A7 Джин ORF экспрессии кДНК клона плазмидыMG52540-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52540-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».