Быстрый заказ

Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь SLC35F4 Информация о продукте «Клон cDNA»
    Размер кДНК:1458bp
    Описание кДНК:Full length Clone DNA of Mus musculus solute carrier family 35, member F4 with C terminal His tag.
    Синоним гена:4930550L21Rik
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with SLC35F4 qPCR primers for gene expression analysis, MP201593 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51720-ACGRBS15400
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51720-ACRRBS15400
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51720-ANGRBS15400
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51720-ANRRBS15400
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51720-CFRBS13340
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51720-CHRBS13340
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51720-CMRBS13340
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51720-CYRBS13340
    Мышь SLC35F4 Джин клон кДНК в вектор клонированияMG51720-GRBS5130
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51720-NFRBS13340
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51720-NHRBS13340
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51720-NMRBS13340
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51720-NYRBS13340
    Мышь SLC35F4 Джин ORF экспрессии кДНК клона плазмидыMG51720-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.