Быстрый заказ

Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SLC25A35 Информация о продукте «Клон cDNA»
Размер кДНК:903bp
Описание кДНК:Full length Clone DNA of Mus musculus solute carrier family 25, member 35 with N terminal HA tag.
Синоним гена:1810012H11Rik, RP23-396M19.7
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51997-ACGRBS15400
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51997-ACRRBS15400
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51997-ANGRBS15400
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51997-ANRRBS15400
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51997-CFRBS13340
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51997-CHRBS13340
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51997-CMRBS13340
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51997-CYRBS13340
Мышь SLC25A35 Джин клон кДНК в вектор клонированияMG51997-GRBS5130
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51997-NFRBS13340
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51997-NHRBS13340
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51997-NMRBS13340
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51997-NYRBS13340
Мышь SLC25A35 Джин ORF экспрессии кДНК клона плазмидыMG51997-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.