SLC25A30 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52068-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All SLC25A30 Reagents

CRO Services

Product recommended


All SLC25A30 Reagents

SLC25A30 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
876 bp
Description
Full length Clone DNA of Mouse solute carrier family 25, member 30 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A30 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

4933433D23Rik cDNA ORF Clone, Mouse;AV025504 cDNA ORF Clone, Mouse;AV221431 cDNA ORF Clone, Mouse;AW319655 cDNA ORF Clone, Mouse;KMCP1 cDNA ORF Clone, Mouse

SLC25A30 Background Information

Full Name
solute carrier family 25, member 30

SLC25A30 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
SLC25A30 cDNA ORF Clone in Cloning Vector, Canine DG70188-U
SLC25A30 cDNA ORF Clone, Canine, untagged DG70188-UT
SLC25A30 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70188-ACGLN
SLC25A30 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70188-ACG
SLC25A30 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70188-ANG
SLC25A30 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70188-ACR
SLC25A30 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70188-ANR
SLC25A30 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70188-CF
SLC25A30 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70188-NF
SLC25A30 cDNA ORF Clone, Canine, C-His tag DG70188-CH
SLC25A30 cDNA ORF Clone, Canine, N-His tag DG70188-NH
SLC25A30 cDNA ORF Clone, Canine, C-HA tag DG70188-CY
SLC25A30 cDNA ORF Clone, Canine, N-HA tag DG70188-NY
SLC25A30 cDNA ORF Clone, Canine, C-Myc tag DG70188-CM
SLC25A30 cDNA ORF Clone, Canine, N-Myc tag DG70188-NM

SLC25A30 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A30 cDNA ORF Clone in Cloning Vector, Mouse MG52068-U
SLC25A30 cDNA ORF Clone, Mouse, untagged MG52068-UT
SLC25A30 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52068-ACGLN
SLC25A30 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52068-ACG
SLC25A30 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52068-ANG
SLC25A30 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52068-ACR
SLC25A30 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52068-ANR
SLC25A30 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52068-NF
SLC25A30 cDNA ORF Clone, Mouse, C-His tag MG52068-CH
SLC25A30 cDNA ORF Clone, Mouse, N-His tag MG52068-NH
SLC25A30 cDNA ORF Clone, Mouse, C-HA tag MG52068-CY
SLC25A30 cDNA ORF Clone, Mouse, N-HA tag MG52068-NY
SLC25A30 cDNA ORF Clone, Mouse, C-Myc tag MG52068-CM
SLC25A30 cDNA ORF Clone, Mouse, N-Myc tag MG52068-NM
SLC25A30 qPCR Primer Pairs, Mouse MP201941

SLC25A30 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A30 cDNA ORF Clone, Human, untagged HG24994-UT
info info
添加购物车成功! 添加购物车失败!