SLC25A20 cDNA ORF Clone, Mouse, C-His tag

Cat: MG52911-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All SLC25A20 Reagents

CRO Services

Product recommended


All SLC25A20 Reagents

SLC25A20 cDNA ORF Clone, Mouse, C-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
906 bp
Description
Full length Clone DNA of Mouse solute carrier family 25 (mitochondrial carnitine>acylcarnitine translocase), member 20 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A20 cDNA ORF Clone, Mouse, C-His tag Alternative Names

1110007P09Rik cDNA ORF Clone, Mouse;C78826 cDNA ORF Clone, Mouse;Cact cDNA ORF Clone, Mouse;mCAC cDNA ORF Clone, Mouse

SLC25A20 Background Information

Full Name
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20

SLC25A20 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SLC25A20 cDNA ORF Clone in Cloning Vector, Rat RG80829-U
SLC25A20 cDNA ORF Clone, Rat, untagged RG80829-UT
SLC25A20 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80829-ACGLN
SLC25A20 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80829-ACG
SLC25A20 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80829-ACR
SLC25A20 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80829-CF
SLC25A20 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80829-NF
SLC25A20 cDNA ORF Clone, Rat, C-His tag RG80829-CH
SLC25A20 cDNA ORF Clone, Rat, N-His tag RG80829-NH
SLC25A20 cDNA ORF Clone, Rat, C-HA tag RG80829-CY
SLC25A20 cDNA ORF Clone, Rat, N-HA tag RG80829-NY
SLC25A20 cDNA ORF Clone, Rat, C-Myc tag RG80829-CM
SLC25A20 cDNA ORF Clone, Rat, N-Myc tag RG80829-NM
SLC25A20 qPCR Primer Pairs, Rat RP300793

SLC25A20 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A20 cDNA ORF Clone in Cloning Vector, Mouse MG52911-G
SLC25A20 cDNA ORF Clone, Mouse, untagged MG52911-UT
SLC25A20 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52911-ACGLN
SLC25A20 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52911-ACG
SLC25A20 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52911-ACR
SLC25A20 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52911-CF
SLC25A20 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52911-NF
SLC25A20 cDNA ORF Clone, Mouse, N-His tag MG52911-NH
SLC25A20 cDNA ORF Clone, Mouse, C-HA tag MG52911-CY
SLC25A20 cDNA ORF Clone, Mouse, N-HA tag MG52911-NY
SLC25A20 cDNA ORF Clone, Mouse, C-Myc tag MG52911-CM
SLC25A20 cDNA ORF Clone, Mouse, N-Myc tag MG52911-NM

SLC25A20 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A20 cDNA ORF Clone in Cloning Vector, Human HG16996-U
SLC25A20 cDNA ORF Clone, Human, untagged HG16996-UT
SLC25A20 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16996-ACGLN
SLC25A20 cDNA ORF Clone, Human, C-GFPSpark® tag HG16996-ACG
SLC25A20 cDNA ORF Clone, Human, N-GFPSpark® tag HG16996-ANG
SLC25A20 cDNA ORF Clone, Human, C-OFPSpark® tag HG16996-ACR
SLC25A20 cDNA ORF Clone, Human, N-OFPSpark® tag HG16996-ANR
SLC25A20 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16996-CF
SLC25A20 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16996-NF
SLC25A20 cDNA ORF Clone, Human, C-His tag HG16996-CH
SLC25A20 cDNA ORF Clone, Human, N-His tag HG16996-NH
SLC25A20 cDNA ORF Clone, Human, C-HA tag HG16996-CY
SLC25A20 cDNA ORF Clone, Human, N-HA tag HG16996-NY
SLC25A20 cDNA ORF Clone, Human, C-Myc tag HG16996-CM
SLC25A20 cDNA ORF Clone, Human, N-Myc tag HG16996-NM
info info
添加购物车成功! 添加购物车失败!