After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SLC25A18 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001081048.2
Размер кДНК:963bp
Описание кДНК:Full length Clone DNA of Mus musculus solute carrier family 25 (mitochondrial carrier), member 18 with N terminal HA tag.
Синоним гена:AW125787, 1500015I14Rik
Виды:Mouse
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51987-ACGRBS15400
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51987-ACRRBS15400
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51987-ANGRBS15400
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51987-ANRRBS15400
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51987-CFRBS13340
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51987-CHRBS13340
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51987-CMRBS13340
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51987-CYRBS13340
Мышь SLC25A18 Джин клон кДНК в вектор клонированияMG51987-GRBS5130
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51987-NFRBS13340
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51987-NHRBS13340
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51987-NMRBS13340
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51987-NYRBS13340
Мышь SLC25A18 Джин ORF экспрессии кДНК клона плазмидыMG51987-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51987-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».