After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SLAMF7 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_144539.5
Размер кДНК:1002bp
Описание кДНК:Full length Clone DNA of Mus musculus SLAM family member 7 with N terminal Myc tag.
Синоним гена:19A, CS1, 19A24, CRACC, 4930560D03Rik, Slamf7
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50201-ACGRBS15400
Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50201-ACRRBS15400
Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50201-CFRBS13340
Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50201-CHRBS13340
Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50201-CMRBS13340
Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50201-CYRBS13340
Мышь CRACC/SLAM7/CD319 Джин клон кДНК в вектор клонированияMG50201-MRBS5130
Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50201-NFRBS13340
Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50201-NHRBS13340
Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50201-NMRBS13340
Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50201-NYRBS13340
Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмидыMG50201-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SLAM family member 7 (SLAMF7), also known as CRACC, CD319, CD2-like receptor-activating cytotoxic cells, and CS1, is a single-pass type I membrane protein and a member of the CD2 family of cell surface receptors. SLAMF7 is expressed in NK cells, activated B-cells, NK-cell line but not in promyelocytic, B-cell lines, or T-cell lines. Although the cytoplasmic domain of CS1 contains immunoreceptor tyrosine-based switch motifs (ITSM), which enables to recruite signaling lymphocyte activation molecule (SLAM)-associated protein (SAP/SH2D1A), it activates NK cells in the absence of a functional SAP. CS1 is a self ligand and homophilic interaction of CS1 regulates NK cell cytolytic activity. CRACC positively regulated natural killer cell functions by a mechanism dependent on the adaptor EAT-2 but not the related adaptor SAP. However, in the absence of EAT-2, CRACC potently inhibited natural killer cell function. It was also inhibitory in T cells, which are typically devoid of EAT-2. Thus, CRACC can exert activating or inhibitory influences on cells of the immune system depending on cellular context and the availability of effector proteins.

Ссылки
  • Lee JK, et al. (2004) Molecular and functional characterization of a CS1 (CRACC) splice variant expressed in human NK cells that does not contain immunoreceptor tyrosine-based switch motifs. Eur J Immunol. 34(10): 2791-9.
  • Tassi I, et al. (2005) The cytotoxicity receptor CRACC (CS-1) recruits EAT-2 and activates the PI3K and phospholipase Cgamma signaling pathways in human NK cells. J Immunol. 175(12): 7996-8002.
  • Lee JK, et al. (2007) CS1 (CRACC, CD319) induces proliferation and autocrine cytokine expression on human B lymphocytes. J Immunol. 179(7): 4672-8.
  • Cruz-Munoz ME, et al. (2009) Influence of CRACC, a SLAM family receptor coupled to the adaptor EAT-2, on natural killer cell function. Nat Immunol. 10(3): 297-305.
  • Size / Price
    Каталог: MG50201-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».