Быстрый заказ

Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь SLAMF7 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_144539.5
    Размер кДНК:1002bp
    Описание кДНК:Full length Clone DNA of Mus musculus SLAM family member 7 with N terminal Myc tag.
    Синоним гена:19A, CS1, 19A24, CRACC, 4930560D03Rik, Slamf7
    Виды:Mouse
    переносчик:pCMV3-SP-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SLAMF7 qPCR primers for gene expression analysis, MP200230 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50201-ACGRBS15400
    Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50201-ACRRBS15400
    Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50201-CFRBS13340
    Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50201-CHRBS13340
    Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50201-CMRBS13340
    Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50201-CYRBS13340
    Мышь CRACC/SLAM7/CD319 Джин клон кДНК в вектор клонированияMG50201-MRBS5130
    Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50201-NFRBS13340
    Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50201-NHRBS13340
    Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50201-NMRBS13340
    Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50201-NYRBS13340
    Мышь CRACC/SLAM7/CD319 Джин ORF экспрессии кДНК клона плазмидыMG50201-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    SLAM family member 7 (SLAMF7), also known as CRACC, CD319, CD2-like receptor-activating cytotoxic cells, and CS1, is a single-pass type I membrane protein and a member of the CD2 family of cell surface receptors. SLAMF7 is expressed in NK cells, activated B-cells, NK-cell line but not in promyelocytic, B-cell lines, or T-cell lines. Although the cytoplasmic domain of CS1 contains immunoreceptor tyrosine-based switch motifs (ITSM), which enables to recruite signaling lymphocyte activation molecule (SLAM)-associated protein (SAP/SH2D1A), it activates NK cells in the absence of a functional SAP. CS1 is a self ligand and homophilic interaction of CS1 regulates NK cell cytolytic activity. CRACC positively regulated natural killer cell functions by a mechanism dependent on the adaptor EAT-2 but not the related adaptor SAP. However, in the absence of EAT-2, CRACC potently inhibited natural killer cell function. It was also inhibitory in T cells, which are typically devoid of EAT-2. Thus, CRACC can exert activating or inhibitory influences on cells of the immune system depending on cellular context and the availability of effector proteins.

    Ссылки
  • Lee JK, et al. (2004) Molecular and functional characterization of a CS1 (CRACC) splice variant expressed in human NK cells that does not contain immunoreceptor tyrosine-based switch motifs. Eur J Immunol. 34(10): 2791-9.
  • Tassi I, et al. (2005) The cytotoxicity receptor CRACC (CS-1) recruits EAT-2 and activates the PI3K and phospholipase Cgamma signaling pathways in human NK cells. J Immunol. 175(12): 7996-8002.
  • Lee JK, et al. (2007) CS1 (CRACC, CD319) induces proliferation and autocrine cytokine expression on human B lymphocytes. J Immunol. 179(7): 4672-8.
  • Cruz-Munoz ME, et al. (2009) Influence of CRACC, a SLAM family receptor coupled to the adaptor EAT-2, on natural killer cell function. Nat Immunol. 10(3): 297-305.
  • Size / Price
    Каталог: MG50201-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».