After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SLAMF6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_030710.2
Размер кДНК:996bp
Описание кДНК:Full length Clone DNA of Mus musculus SLAM family member 6.
Синоним гена:KAL1, NTBA, KAL1b, Ly108, NTB-A, SF2000, Slamf6
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50275-ACGRBS15400
Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50275-ACRRBS15400
Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50275-CFRBS13340
Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50275-CHRBS13340
Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50275-CMRBS13340
Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50275-CYRBS13340
Мышь Ly108/SLAMF6 Джин клон кДНК в вектор клонированияMG50275-MRBS5130
Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50275-NFRBS13340
Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50275-NHRBS13340
Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50275-NMRBS13340
Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50275-NYRBS13340
Мышь Ly108/SLAMF6 Джин ORF экспрессии кДНК клона плазмидыMG50275-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SLAM family member 6, also known as Activating NK receptor, NK-T-B-antigen, NTB-A, SLAMF6, KALI and Ly108, is a single-pass type I membrane protein which belongs to the CD2 subfamily of the immunoglobulin superfamily. SLAMF6 / Ly108 contains one Ig-like (immunoglobulin-like) domain. It is expressed by all (resting and activated) natural killer cells (NK), T- and B-lymphocytes. SLAMF6 / Ly108 triggers cytolytic activity only in natural killer cells (NK) expressing high surface densities of natural cytotoxicity receptors. SLAMF6 / Ly108 is a homodimer. It interacts with PTN6 and, upon phosphorylation, with PTN11 and SH2D1A/SAP. SLAMF6 / Ly108 undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It may function as a coreceptor in the process of NK cell activation. SLAMF6 / Ly108 can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients.

Ссылки
  • Gray CW. et al., 2000, Eur J Biochem. 267 (18): 5699-710.
  • Bottino C. et al., 2001, J Exp Med. 194 (3): 235-46.
  • Valdez PA. et al., 2004, J Biol Chem. 279 (18): 18662-9.
  • Claus M. et al., 2007, Front Biosci. 13: 956-65.
  • Size / Price
    Каталог: MG50275-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».