After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SIGIRR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_023059.3
Размер кДНК:1230bp
Описание кДНК:Full length Clone DNA of Mus musculus single immunoglobulin and toll-interleukin 1 receptor (TIR) domain with N terminal His tag.
Синоним гена:TIR8, AI256711, MGC102426
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50122-ACGRBS15400
Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50122-ACRRBS15400
Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50122-CFRBS13340
Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50122-CHRBS13340
Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50122-CMRBS13340
Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50122-CYRBS13340
Мышь SIGIRR/TIR8 Джин клон кДНК в вектор клонированияMG50122-MRBS5130
Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50122-NFRBS13340
Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50122-NHRBS13340
Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50122-NMRBS13340
Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50122-NYRBS13340
Мышь SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмидыMG50122-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Single Ig IL-1-related receptor (SIGIRR) or TIR8 is a member of Toll-like receptor-interleukin 1 receptor signaling (TLR-IL-1R) receptor superfamily. Although SIGIRR/TIR8 shows the typical conserved motifs that characterize the IL-1R and Toll superfamily, it is structurally and functionally distinct from both. SIGIRR/TIR8 has only one Ig domain in its extracellular portion whereas the IL-1R family contains three Ig folds. An unusually long cytoplasmic domain is reminiscent of the structure of drosophila Toll, yet the SIGIRR peptide sequence is more closely related to IL-1RI. SIGIRR/TIR8 was mainly expressed in mouse and human epithelial tissues such as kidney, lung and gut. Resting and activated T and B lymphocytes and monocytes-macrophages expressed little or no SIGIRR/TIR8, with the exception of the mouse GG2EE macrophage line. Inflammation is enhanced in SIGIRR-deficient mice. SIGIRR negatively modulates immune responses. Inflammation is enhanced in SIGIRR-deficient mice, as shown by their enhanced chemokine induction after IL-1 injection and reduced threshold for lethal endotoxin challenge.

Ссылки
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Polentarutti N, et al. (2003) Unique pattern of expression and inhibition of IL-1 signaling by the IL-1 receptor family member TIR8/SIGIRR. Eur Cytokine Netw. 14(4): 211-8.
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Size / Price
    Каталог: MG50122-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».