Быстрый заказ

Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь SH3GLB1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:AF272946.1
    Размер кДНК:1161bp
    Описание кДНК:Full length Clone DNA of Mus musculus SH3-domain GRB2-like B1 (endophilin) with C terminal Myc tag.
    Синоним гена:Bif-1, AA409932, AI314629, AU015566, mKIAA0491
    Виды:Mouse
    переносчик:pCMV3-C-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SH3GLB1 qPCR primers for gene expression analysis, MP201509 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51636-ACGRBS15400
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51636-ACRRBS15400
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51636-ANGRBS15400
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51636-ANRRBS15400
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51636-CFRBS13340
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51636-CHRBS13340
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51636-CMRBS13340
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51636-CYRBS13340
    Мышь SH3GLB1 Джин клон кДНК в вектор клонированияMG51636-GRBS5130
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51636-NFRBS13340
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51636-NHRBS13340
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51636-NMRBS13340
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51636-NYRBS13340
    Мышь SH3GLB1 Джин ORF экспрессии кДНК клона плазмидыMG51636-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51636-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».