After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SH3BGRL3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_080559.1
Размер кДНК:282bp
Описание кДНК:Full length Clone DNA of Mus musculus SH3 domain binding glutamic acid-rich protein-like 3 with C terminal Myc tag.
Синоним гена:AU022188, 1110004L05Rik
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52787-ACGRBS15400
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52787-ACRRBS15400
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52787-ANGRBS15400
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52787-ANRRBS15400
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52787-CFRBS13340
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52787-CHRBS13340
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52787-CMRBS13340
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52787-CYRBS13340
Мышь SH3BGRL3 Джин клон кДНК в вектор клонированияMG52787-GRBS5130
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52787-NFRBS13340
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52787-NHRBS13340
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52787-NMRBS13340
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52787-NYRBS13340
Мышь SH3BGRL3 Джин ORF экспрессии кДНК клона плазмидыMG52787-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52787-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».