After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SH2D5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001099631.1
Размер кДНК:1290bp
Описание кДНК:Full length Clone DNA of Mus musculus SH2 domain containing 5 with N terminal His tag.
Синоним гена:BC036961
Виды:Mouse
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51986-ACGRBS15400
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51986-ACRRBS15400
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51986-ANGRBS15400
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51986-ANRRBS15400
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51986-CFRBS13340
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51986-CHRBS13340
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51986-CMRBS13340
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51986-CYRBS13340
Мышь SH2D5 Джин клон кДНК в вектор клонированияMG51986-GRBS5130
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51986-NFRBS13340
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51986-NHRBS13340
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51986-NMRBS13340
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51986-NYRBS13340
Мышь SH2D5 Джин ORF экспрессии кДНК клона плазмидыMG51986-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51986-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».