Быстрый заказ

Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SGMS1 Информация о продукте «Клон cDNA»
Размер кДНК:1260bp
Описание кДНК:Full length Clone DNA of Mus musculus sphingomyelin synthase 1 with N terminal His tag.
Синоним гена:Mob, Sms1, Sor1, C80702, Tmem23, AI841905, 9530058O11Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51982-ACGRBS15400
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51982-ACRRBS15400
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51982-ANGRBS15400
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51982-ANRRBS15400
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51982-CFRBS13340
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51982-CHRBS13340
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51982-CMRBS13340
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51982-CYRBS13340
Мышь SGMS1 Джин клон кДНК в вектор клонированияMG51982-GRBS5130
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51982-NFRBS13340
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51982-NHRBS13340
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51982-NMRBS13340
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51982-NYRBS13340
Мышь SGMS1 Джин ORF экспрессии кДНК клона плазмидыMG51982-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51982-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.