After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse SGK1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_011361.1
Размер кДНК:1296bp
Описание кДНК:Full length Clone DNA of Mus musculus serum/glucocorticoid regulated kinase 1.
Синоним гена:Sgk, Sgk1
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50278-ACGRBS15400
Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50278-ACRRBS15400
Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50278-CFRBS13340
Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50278-CHRBS13340
Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50278-CMRBS13340
Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50278-CYRBS13340
Мышь SGK1/SGK Джин клон кДНК в вектор клонированияMG50278-MRBS5130
Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50278-NFRBS13340
Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50278-NHRBS13340
Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50278-NMRBS13340
Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50278-NYRBS13340
Мышь SGK1/SGK Джин ORF экспрессии кДНК клона плазмидыMG50278-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50278-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».